Posts filtered by tags: Gattaca[x]


 

Planned Film About Jacinda Ardern And Christchurch Mosque Massacre Draws Huge Backlash In New Zealand

The just-announced project They Are Us, to be written and directed by New Zealander Andrew Niccol (writer and co-producer of The Truman Show, writer-director of, among others, Gattaca and Good Kill) and starring Rose Byrne, focuses on the aftermath of the 2019 mass shooting and the national campaign led by Prime Minister Ardern to ban assault rifles in the country. Within a day of the news arriving, many Kiwis reacted with fury to the focus on white politicians rather than the Muslim victims an...
Tags: Art, Media, New Zealand, Muslim, Rose Byrne, Gattaca, Andrew Niccol, Jacinda Ardern, Ardern, White Saviour, 06.11.21, Christchurch Mosque Massacre


New on Blu-ray: World of Wong Kar Wai, ‘Barb and Star Go to Vista Del Mar’, ‘Soul’, ‘Godzilla’ 4K, ‘Gattaca’ 4K, ‘News of the World’, and ‘The Reckoning’

The time has come yet again to highlight some great physical media, and this edition is our most jam-packed in a while. It’s so jam-packed it might as well be jelly. You have the wonderful new Criterion box set World of Wong Kari Wai; the delightfully silly Barb and Star Go to Vista Del Mar, Pixar’s Soul, new 4K releases of both Godzilla and Gattaca, Tom Hanks in News of the World, and the horror film The Reckoning. World of Wong Kar Wai Few filmmakers, if any, capture the feeling of ye...
Tags: Hong Kong, Movies, Jamie Dornan, Disney, Earth, Star, Features, Soul, Tom Hanks, Paul Greengrass, News Of The World, Tina Fey, Jamie Foxx, Pixar, Mike Jones, Godzilla


How gene editing could protect us from future pandemics

Hollywood’s blockbusters such as X-men, Gattaca, and Jurassic World have explored the intriguing concept of “germline genome editing” – a biomolecular technique that can alter the DNA of sperm, eggs, or embryos. If you remove a gene that causes a certain disease in an embryo, not only will the baby be free of the disease when born – so will its descendants. The technique is, however, controversial – we can’t be sure how a child with an altered genome will develop over a lifetime. But with the CO...
Tags: Startups, Hollywood, Gattaca, Syndication


Good Movies as Old Books: 100 Films Reimagined as Vintage Book Covers

At one time paperback books were thought of as trash, a term that described their perceived artistic and cultural level, production value, and utter disposability. This changed in the mid-20th century, when certain paperback publishers (Doubleday Anchor, for example, who hired Edward Gorey to design their covers in the 1950s) made a push for respectability. It worked so well that the signature aesthetics they developed still, nearly a lifetime later, pique our interest more readily than those o...
Tags: Google, Facebook, Books, Design, Film, College, Wes Anderson, Ridley Scott, Philip K Dick, Seoul, Alfred Hitchcock, David Fincher, Stephen Frears, Agatha Christie, Steven Spielberg, Rian Johnson


The Morning Watch: Crafting the Wonder of ‘Wonder Woman’, Reviewing Futuristic Movies & More

The Morning Watch is a recurring feature that highlights a handful of noteworthy videos from around the web. They could be video essays, fanmade productions, featurettes, short films, hilarious sketches, or just anything that has to do with our favorite movies and TV shows. In this edition, watch an extensive featurette that goes behind the scenes of the first Wonder Woman movie. Plus, see what a futurist thinks of how the future was depicted in movies like The Matrix, WALL-E, Total Recall, and...
Tags: Hbo, Movies, Seth-Rogen, Vanity Fair, Gattaca, Ex Machina, Gal Gadot, Simon Rich, Evan-Goldberg, Patty-Jenkins, Video Of The Day, Wonder-Woman, Total Recall, 2001:-A-Space-Odyssey, Brandon Trost, Wall-e


The Ridiculous Way Gattaca Used A Forklift To Try And Save Money During Shooting

This bit of movie magic from 1997's Gattaca is totally unexpected.
Tags: Religion, Gattaca


Complete genome of SARS-CoV-2

Here is the complete genome of SARS-CoV-2, specifically the Wuhan-Hi-1 isolate (there are many to pick from). So little information, so much trouble! ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTAC...
Tags: Post, News, Wuhan, Gattaca, Rona


10 Nerdy Things to Watch on CBS All Access (Besides Star Trek)

We love Star Trek. And Star Trek is clearly the number one reason to get a CBS All Access account, especially with the 60-day free promotion the streamer has going on at the moment. But what else does CBS’s online hub have, besides Picard and other Treks, and, like, NCIS spin-offs? We did some digging for you.Read more...
Tags: Science, Evil, Marvel, Streaming, Cbs, Tobey Maguire, The Twilight Zone, Gore Verbinski, Cbs All Access, Gattaca, Spider Man, Rod Serling, Zombieland, Sam Raimi, Picard, Jordan Peele


"My wife got [a print of a boy on a horse asking, 'What is the bravest thing you’ve ever said?' to which the horse replies, 'Help'] for my birthday, and of all the things that we have..."

"... it’s the thing that I cherish quite a bit. It’s the only thing I pass when I leave my bedroom every day when I’m home. And it’s a reminder that strength is not necessarily being physically strong, but it’s asking for help, to be vulnerable, to be the person that I’m not supposed to be, right? And that’s not necessarily a bad thing."Item #2 on a list of 10 "essential" things in "David Chang Loves Beethoven’s Ninth (but Won’t Finish ‘Infinite Jest’)/The chef, author and television personality...
Tags: Law, Journalism, Fox, Netflix, Ethics, Beethoven, Fox News, Horse, Solitude, Gattaca, Trump, Bhagavad Gita, Regan, David Chang, Trish Regan, Ann Althouse


The Explorer and The Hermit

In a piece called I’m the Food Expert But My Kids Love My Husband’s Cooking, Amanda Hesser talks about food, tradition, and the differing cooking styles between her and her husband Tad. When she was younger, Hesser’s approach was to experiment relentlessly with her cooking, moving from one new dish to the next. But her husband took a different approach: One of my other nicknames for Tad is Mr. Efficiency. He obsesses over the shortest route to a destination, orders everything in bulk, is always...
Tags: Berlin, Ethan Hawke, Istanbul, Gattaca, Jason Kottke, Don, Dunkin Donuts, Amanda Hesser, Hesser, Jerome Jerome


Now Stream This: ‘McCabe & Mrs. Miller’, ‘Revenge’, ‘Hamlet’, ‘They Came Together’, and More

(Welcome to Now Stream This, a column dedicated to the best movies streaming on Netflix, Amazon, Hulu, and every other streaming service out there.)  Another edition of Now Stream This is here to offer you a smorgasbord of streaming options! Be honest – you don’t want to leave your house. You want to stay inside and watch movies without getting up off the couch. If you find yourself in this situation, but remain uncertain about just what to watch, this column is here to help. In this edition, w...
Tags: Comedy, Movies, Drama, Horror, Fantasy, Demon, Western, Features, Ethan Hawke, Amy Poehler, Revenge, Kate Winslet, Stronger, Beatty, Gore Vidal, Kenneth Branagh


Anon

I’ve been very disappointed with a lot of Netflix’s sci-fi releases, especially when it comes to movies, and so came in to this with low expectations, even if I was quite interested in watching it. By the director of Gattaca, it feels stylish in that same way, and has an interesting premise — our eyes now include an overlay of info, and record everything. I won’t say that it blew me away, but I enjoyed watching it. This is the kind of sci-fi content I’d like to see more of, giving interesting c...
Tags: Travel, Movies, Netflix, Gattaca, Anon, Debaser


Trailer Round-Up: Clive Owen Leads ‘Anon’, Kelly MacDonald Solves a ‘Puzzle’, & More

Gather around, movie fans! Come one, come all, to this collection of three new trailers all in one place. Step right up and watch trailers for Anon, Puzzle, and Director’s Cut, and find out which of those is a futuristic sci-fi mystery that poses the question “Who can hack a human being?” with a deadly serious tone. Anon Trailer If you thought that looked like a lower-budget Inception rip-off, you’d be right. But hopefully there’s a bit more going on here than this trailer indicates, bec...
Tags: Movies, Puzzle, Drama, Netflix, Thriller, Movie Trailers, Independent, Gattaca, Sal, Agnes, MacDonald, Sony Pictures Classics, Clive Owen, Andrew Niccol, Amanda Seyfried, Penn Jillette


Why We Should All Be Worried About Congress Eroding Protections Against Genetic Discrimination

In the sci-fi thriller Gattaca, Ethan Hawke struggles to compete in life and work as a biologically inferior human born without the aid of genetic selection. In Gattaca’s vision of the future, selectively breeding desirable traits into humans is common. And while genetic discrimination is technically illegal, genetic…Read more...
Tags: Science, Congress, Ethan Hawke, Gattaca, Genetic Privacy, Genetic Discrimination


Was Star Wars' Naboo secretly designed by Frank Lloyd Wright?

A Bay Area commuter approaching Terra Linda from US 101 will notice something strange just east of the freeway in San Rafael. A futuristic, robin egg blue spaceship emerges majestically from the expansive landscape, then transforms into a massive structure that is dwarfed only by the two valleys it spans. This unusual and eyecatching building, the Marin County Civic Center, was nominated in early 2015 for the UNESCO World Heritage List and is best known as Frank Lloyd Wright’s final and largest...
Tags: Art, Star Wars, Science Fiction, Design, US, San Francisco, Features, Architecture, George Lucas, Unesco World Heritage List, Organic Architecture, Gattaca, Frank Lloyd Wright, Bay Area, Naboo, Marin


Creepy poster of Trump's kids

The above image is the Trump campaign's latest outreach effort, this time toward young people! It has a certain vibe to it, clean but sinister, yet comically unconvincing. As summed up by author Saladin Ahmed's remark: "They look like a version of GATTACA that's extremely lax about genetic testing." Gattaca is a brilliant film about a man with a genetic flaw, struggling against DNA discrimination in a clinical, cooly fascistic future. If the private space industry's reluctance to hire someone ...
Tags: Post, News, Gattaca, Trump, Saladin Ahmed


Was Star Wars’ Naboo secretly designed by Frank Lloyd Wright?

A Bay Area commuter approaching Terra Linda from US 101 will notice something strange just east of the freeway in San Rafael. A futuristic, robin egg blue spaceship emerges majestically from the expansive landscape, then transforms into a massive structure that is dwarfed only by the two valleys it spans. This unusual and eyecatching building, the Marin County Civic Center, was nominated in early 2015 for the UNESCO World Heritage List and is best known as Frank Lloyd Wright’s final and largest...
Tags: Art, Star Wars, Science Fiction, Design, US, San Francisco, Features, Architecture, George Lucas, Unesco World Heritage List, Organic Architecture, Gattaca, Frank Lloyd Wright, Bay Area, Naboo, Marin